Transcript: Human NM_001184786.1

Homo sapiens par-3 family cell polarity regulator (PARD3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
PARD3 (56288)
Length:
5965
CDS:
331..4353

Additional Resources:

NCBI RefSeq record:
NM_001184786.1
NBCI Gene record:
PARD3 (56288)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184786.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307353 ACACGGGTTTGGAGCATATAC pLKO_005 1100 CDS 100% 13.200 18.480 N PARD3 n/a
2 TRCN0000118134 GCCATCGACAAATCTTATGAT pLKO.1 3064 CDS 100% 5.625 7.875 N PARD3 n/a
3 TRCN0000307858 GCCATCGACAAATCTTATGAT pLKO_005 3064 CDS 100% 5.625 7.875 N PARD3 n/a
4 TRCN0000118136 CCACGCAGATTTGGGAATCTT pLKO.1 2130 CDS 100% 0.563 0.788 N PARD3 n/a
5 TRCN0000294487 AGTCAATTGGATTTCGTTAAA pLKO_005 2800 CDS 100% 13.200 9.240 N PARD3 n/a
6 TRCN0000118133 CGAGGAATGATCCAGCTTATT pLKO.1 2308 CDS 100% 13.200 9.240 N PARD3 n/a
7 TRCN0000291920 CGAGGAATGATCCAGCTTATT pLKO_005 2308 CDS 100% 13.200 9.240 N PARD3 n/a
8 TRCN0000118135 CCATCGACAAATCTTATGATA pLKO.1 3065 CDS 100% 5.625 3.938 N PARD3 n/a
9 TRCN0000118132 CCCAGCAACTATGACTCGTAT pLKO.1 4201 CDS 100% 4.950 2.970 N PARD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184786.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.