Transcript: Human NM_001184961.1

Homo sapiens paternally expressed 10 (PEG10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PEG10 (23089)
Length:
6628
CDS:
378..2605

Additional Resources:

NCBI RefSeq record:
NM_001184961.1
NBCI Gene record:
PEG10 (23089)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235167 GAGGTCACTACGCTGACAATT pLKO_005 1381 CDS 100% 13.200 18.480 N PEG10 n/a
2 TRCN0000235168 CCACAACCGCCACTCTATTAT pLKO_005 1943 CDS 100% 15.000 10.500 N PEG10 n/a
3 TRCN0000235166 AGTCGCTGTCTGCTCTGATTG pLKO_005 1153 CDS 100% 10.800 7.560 N PEG10 n/a
4 TRCN0000235164 TGGAAATGAAGCATGTCTTTG pLKO_005 934 CDS 100% 10.800 7.560 N PEG10 n/a
5 TRCN0000235165 CCAATGCTTTCCAGATGATTG pLKO_005 1033 CDS 100% 10.800 6.480 N PEG10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02720 pDONR223 100% 43.8% 90.5% None 1_102del;1078_2225del n/a
2 ccsbBroad304_02720 pLX_304 0% 43.8% 90.5% V5 1_102del;1078_2225del n/a
Download CSV