Transcript: Human NM_001185015.2

Homo sapiens SP110 nuclear body protein (SP110), transcript variant d, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SP110 (3431)
Length:
2023
CDS:
166..1833

Additional Resources:

NCBI RefSeq record:
NM_001185015.2
NBCI Gene record:
SP110 (3431)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001185015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421799 CCCAATCTGGTGACGATTTAC pLKO_005 463 CDS 100% 13.200 18.480 N SP110 n/a
2 TRCN0000019132 CGCAAAGAACTGGAAACGGAA pLKO.1 1713 CDS 100% 2.640 3.696 N SP110 n/a
3 TRCN0000019131 CCTCCTAGACAACTCCATCAT pLKO.1 291 CDS 100% 4.950 3.960 N SP110 n/a
4 TRCN0000420679 TCAAATTAACCTGCGTGAATA pLKO_005 441 CDS 100% 13.200 9.240 N SP110 n/a
5 TRCN0000019133 CCTGTCTCTTCTGGTGACATT pLKO.1 414 CDS 100% 4.950 3.465 N SP110 n/a
6 TRCN0000019130 CCAGAACCAAATGACCCAGAA pLKO.1 952 CDS 100% 4.050 2.430 N SP110 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001185015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13881 pDONR223 100% 98.2% 1.9% None (many diffs) n/a
2 ccsbBroad304_13881 pLX_304 0% 98.2% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV