Transcript: Mouse NM_001190406.1

Mus musculus growth arrest-specific 2 like 1 (Gas2l1), transcript variant gamma, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gas2l1 (78926)
Length:
3631
CDS:
134..997

Additional Resources:

NCBI RefSeq record:
NM_001190406.1
NBCI Gene record:
Gas2l1 (78926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247529 TGCCTGAAGTGCTCATGTTTG pLKO_005 480 CDS 100% 10.800 15.120 N Gas2l1 n/a
2 TRCN0000247527 ACGCCCAATGACCTTCGAAAC pLKO_005 734 CDS 100% 6.000 8.400 N Gas2l1 n/a
3 TRCN0000247528 GACCAGTTTCCCATGATCAAG pLKO_005 800 CDS 100% 4.950 3.465 N Gas2l1 n/a
4 TRCN0000198525 GCTGAAGAGGATGTCACTGAA pLKO.1 671 CDS 100% 4.950 3.465 N Gas2l1 n/a
5 TRCN0000247526 GGCCGATTGGCTCAATGCTTT pLKO_005 232 CDS 100% 4.950 3.465 N Gas2l1 n/a
6 TRCN0000181663 GCTCATGTTTGAGACAGAGGA pLKO.1 490 CDS 100% 2.640 1.584 N Gas2l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.