Transcript: Human NM_001191055.2

Homo sapiens endogenous retrovirus group V member 2, envelope (ERVV-2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ERVV-2 (100271846)
Length:
3033
CDS:
605..2212

Additional Resources:

NCBI RefSeq record:
NM_001191055.2
NBCI Gene record:
ERVV-2 (100271846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001191055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128658 CAAACCTCTACACTTGCATTA pLKO.1 1446 CDS 100% 10.800 5.400 Y ERVV-1 n/a
2 TRCN0000148928 CCTTTGATGGAAGTCCTAAGA pLKO.1 1401 CDS 100% 4.950 2.475 Y ERVV-1 n/a
3 TRCN0000149617 GTACCAGAGATAGCATCTCTA pLKO.1 1689 CDS 100% 0.000 0.000 Y ERVV-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001191055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13239 pDONR223 100% 59.6% 57.1% None (many diffs) n/a
2 ccsbBroad304_13239 pLX_304 0% 59.6% 57.1% V5 (many diffs) n/a
3 TRCN0000474002 GCCGTTGACTATCTGAGGCGACGA pLX_317 30.3% 59.6% 57.1% V5 (many diffs) n/a
Download CSV