Transcript: Human NM_001193493.2

Homo sapiens solute carrier family 1 member 4 (SLC1A4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SLC1A4 (6509)
Length:
3699
CDS:
276..980

Additional Resources:

NCBI RefSeq record:
NM_001193493.2
NBCI Gene record:
SLC1A4 (6509)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038640 CCGTACGTATGCAACCGATTA pLKO.1 179 5UTR 100% 10.800 15.120 N SLC1A4 n/a
2 TRCN0000428782 AGATAGAAGGGATGAACATTT pLKO_005 265 5UTR 100% 13.200 9.240 N SLC1A4 n/a
3 TRCN0000434384 AGCTCAACGCAGGACAGATTT pLKO_005 580 CDS 100% 13.200 9.240 N SLC1A4 n/a
4 TRCN0000038641 CAAGAGGATCAGCAGGTTTAT pLKO.1 470 CDS 100% 13.200 9.240 N SLC1A4 n/a
5 TRCN0000421653 AGGAACTTGCTGAGGTGAAAG pLKO_005 841 CDS 100% 10.800 7.560 N SLC1A4 n/a
6 TRCN0000421719 GACAAGGACACTCTGACATTC pLKO_005 1170 3UTR 100% 10.800 7.560 N SLC1A4 n/a
7 TRCN0000418203 TGTACACCAGGGATCTGTTTG pLKO_005 1220 3UTR 100% 10.800 7.560 N SLC1A4 n/a
8 TRCN0000038642 ACCACCTGAATCAGAAGGCAA pLKO.1 805 CDS 100% 2.640 1.848 N SLC1A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.