Transcript: Human NM_001193509.2

Homo sapiens tetratricopeptide repeat domain 27 (TTC27), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TTC27 (55622)
Length:
2641
CDS:
147..2528

Additional Resources:

NCBI RefSeq record:
NM_001193509.2
NBCI Gene record:
TTC27 (55622)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144630 GCTGAAGAGATCGCTATTATT pLKO.1 1017 CDS 100% 15.000 21.000 N TTC27 n/a
2 TRCN0000140963 CCCACTCCTCAGGAACATTTA pLKO.1 909 CDS 100% 13.200 9.240 N TTC27 n/a
3 TRCN0000144039 CGGAAAGACAACAGTTGATAT pLKO.1 256 CDS 100% 13.200 9.240 N TTC27 n/a
4 TRCN0000121614 GCAGACCAATTTGAAGATAAA pLKO.1 1236 CDS 100% 13.200 9.240 N TTC27 n/a
5 TRCN0000145581 CCAATTGTTGGGAGAAAGATA pLKO.1 2236 CDS 100% 5.625 3.938 N TTC27 n/a
6 TRCN0000141464 CCAAGACCTAAGCAACCAGTT pLKO.1 2492 CDS 100% 4.050 2.835 N TTC27 n/a
7 TRCN0000142287 GCAGGTAGTAACATTCCTGGA pLKO.1 212 CDS 100% 2.160 1.512 N TTC27 n/a
8 TRCN0000122632 GCTGGAAGCAGATTCTGGAAA pLKO.1 2533 3UTR 100% 4.950 2.970 N TTC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08554 pDONR223 100% 94% 94% None 0_1ins150;1470C>T n/a
2 ccsbBroad304_08554 pLX_304 0% 94% 94% V5 0_1ins150;1470C>T n/a
Download CSV