Transcript: Mouse NM_001195031.1

Mus musculus phosphoprotein associated with glycosphingolipid microdomains 1 (Pag1), transcript variant A, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Pag1 (94212)
Length:
8256
CDS:
679..1968

Additional Resources:

NCBI RefSeq record:
NM_001195031.1
NBCI Gene record:
Pag1 (94212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124814 CCTTCCAAACAGAGCCTTAAT pLKO.1 2671 3UTR 100% 13.200 9.240 N Pag1 n/a
2 TRCN0000124817 CAAGTCCACTTCTGCCTTGAA pLKO.1 1281 CDS 100% 4.950 3.465 N Pag1 n/a
3 TRCN0000124816 GAGAGTGACTACGAGAGCATT pLKO.1 1909 CDS 100% 4.950 3.465 N Pag1 n/a
4 TRCN0000124818 GATCAAGGAAGTGGCAGACAA pLKO.1 1242 CDS 100% 4.950 3.465 N Pag1 n/a
5 TRCN0000124815 CCATGTATGAAAGGGCCAGAA pLKO.1 1663 CDS 100% 4.050 2.835 N Pag1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.