Transcript: Human NM_001195728.3

Homo sapiens solute carrier family 1 member 2 (SLC1A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SLC1A2 (6506)
Length:
11639
CDS:
253..1950

Additional Resources:

NCBI RefSeq record:
NM_001195728.3
NBCI Gene record:
SLC1A2 (6506)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001195728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433459 TGCTTTATAACCGTCTAATTT pLKO_005 2143 3UTR 100% 15.000 21.000 N SLC1A2 n/a
2 TRCN0000427302 ATCGAGTGCATGAAGATATTG pLKO_005 1748 CDS 100% 13.200 10.560 N SLC1A2 n/a
3 TRCN0000432146 ACATGGTAACAGTGATCATAG pLKO_005 1172 CDS 100% 10.800 7.560 N SLC1A2 n/a
4 TRCN0000043170 CCTGCTTTCAACAGATTCAAA pLKO.1 773 CDS 100% 5.625 3.938 N SLC1A2 n/a
5 TRCN0000043171 CCACAGGGAAAGCAACTCTAA pLKO.1 1809 CDS 100% 4.950 3.465 N SLC1A2 n/a
6 TRCN0000043168 CCGCCATCTTTATAGCCCAAA pLKO.1 1448 CDS 100% 4.050 2.835 N SLC1A2 n/a
7 TRCN0000043172 GCAGTGTTGAGGAAGAACCTT pLKO.1 1913 CDS 100% 3.000 2.100 N SLC1A2 n/a
8 TRCN0000043169 CCCTCTAATCATCTCCAGCTT pLKO.1 507 CDS 100% 2.640 1.848 N SLC1A2 n/a
9 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 4036 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4142 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4142 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.