Transcript: Human NM_001198679.1

Homo sapiens RUNX1 partner transcriptional co-repressor 1 (RUNX1T1), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
RUNX1T1 (862)
Length:
7454
CDS:
188..2179

Additional Resources:

NCBI RefSeq record:
NM_001198679.1
NBCI Gene record:
RUNX1T1 (862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013664 CCAGCGGTACAGTCCAAATAA pLKO.1 1183 CDS 100% 15.000 21.000 N RUNX1T1 n/a
2 TRCN0000374869 CCAGCGGTACAGTCCAAATAA pLKO_005 1183 CDS 100% 15.000 21.000 N Runx1t1 n/a
3 TRCN0000271236 CAAGCGACCATGCACTATTAG pLKO_005 1156 CDS 100% 13.200 18.480 N RUNX1T1 n/a
4 TRCN0000313327 CAAGCGACCATGCACTATTAG pLKO_005 1156 CDS 100% 13.200 18.480 N Runx1t1 n/a
5 TRCN0000271291 GCATTACCGTTTGGATGATAT pLKO_005 1258 CDS 100% 13.200 18.480 N RUNX1T1 n/a
6 TRCN0000271292 GCGATCTCTCACCGTACTAAG pLKO_005 1480 CDS 100% 10.800 15.120 N RUNX1T1 n/a
7 TRCN0000013665 CCAGTTCATTTACACCGACAA pLKO.1 567 CDS 100% 4.050 5.670 N RUNX1T1 n/a
8 TRCN0000013666 CCATCTGTTAAACTGCATAAT pLKO.1 1438 CDS 100% 13.200 10.560 N RUNX1T1 n/a
9 TRCN0000271234 GAGTAAGACATTGGGTCTATT pLKO_005 3114 3UTR 100% 13.200 10.560 N RUNX1T1 n/a
10 TRCN0000284357 ATGACATTTCACCCGAGATAG pLKO_005 777 CDS 100% 10.800 7.560 N RUNX1T1 n/a
11 TRCN0000013667 CGTCAAGAAGAAATGATTGAT pLKO.1 1370 CDS 100% 5.625 3.938 N RUNX1T1 n/a
12 TRCN0000013663 CGTAATGACTTATTGTGGATA pLKO.1 2371 3UTR 100% 4.950 3.465 N RUNX1T1 n/a
13 TRCN0000096598 TGGGCAGAAGAGTGGAAACAT pLKO.1 1412 CDS 100% 5.625 3.375 N Runx1t1 n/a
14 TRCN0000312267 TGGGCAGAAGAGTGGAAACAT pLKO_005 1412 CDS 100% 5.625 3.375 N Runx1t1 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2955 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.