Transcript: Human NM_001198983.1

Homo sapiens tubulin epsilon and delta complex 1 (TEDC1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TEDC1 (283643)
Length:
1629
CDS:
254..1318

Additional Resources:

NCBI RefSeq record:
NM_001198983.1
NBCI Gene record:
TEDC1 (283643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198983.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263795 TGGCACAACTACCTGAGGATG pLKO_005 423 CDS 100% 4.050 3.240 N TEDC1 n/a
2 TRCN0000282812 TGGGTCTTGGAGGAGCAGATT pLKO_005 1370 3UTR 100% 4.950 3.465 N TEDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198983.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13504 pDONR223 100% 67.1% 61.3% None (many diffs) n/a
2 ccsbBroad304_13504 pLX_304 0% 67.1% 61.3% V5 (many diffs) n/a
3 TRCN0000472525 AGTACTGAGGTTTATGTCAATTTA pLX_317 59.1% 67.1% 61.3% V5 (many diffs) n/a
Download CSV