Transcript: Human NM_001199011.2

Homo sapiens dynactin subunit 5 (DCTN5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DCTN5 (84516)
Length:
586
CDS:
78..332

Additional Resources:

NCBI RefSeq record:
NM_001199011.2
NBCI Gene record:
DCTN5 (84516)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310295 AGACGGCATCTGGGAACAAAG pLKO_005 121 CDS 100% 10.800 7.560 N DCTN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04394 pDONR223 100% 38.2% 21.5% None (many diffs) n/a
2 ccsbBroad304_04394 pLX_304 0% 38.2% 21.5% V5 (many diffs) n/a
3 TRCN0000467642 AGCGCCGATTGAAAAGCCATGATG pLX_317 60.6% 38.2% 21.5% V5 (many diffs) n/a
Download CSV