Transcript: Mouse NM_001199024.1

Mus musculus phospholipase A2, group VI (Pla2g6), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pla2g6 (53357)
Length:
3560
CDS:
779..3037

Additional Resources:

NCBI RefSeq record:
NM_001199024.1
NBCI Gene record:
Pla2g6 (53357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277533 CAGTAAATCCATGGCCTATAT pLKO_005 2206 CDS 100% 13.200 18.480 N Pla2g6 n/a
2 TRCN0000182672 GCCTGTAACCTGTGTAGATGT pLKO.1 2719 CDS 100% 4.950 6.930 N Pla2g6 n/a
3 TRCN0000181241 CAACTTGTTCTCGAACCCATT pLKO.1 823 CDS 100% 4.050 5.670 N Pla2g6 n/a
4 TRCN0000277465 CGTGAAAGGCCTGGTCATTAT pLKO_005 2077 CDS 100% 13.200 10.560 N Pla2g6 n/a
5 TRCN0000234564 AGTTCCTGAAGCGGGAGTTTG pLKO_005 2301 CDS 100% 10.800 7.560 N PLA2G6 n/a
6 TRCN0000182293 GAGACCGAGGTCTACATCTAT pLKO.1 2966 CDS 100% 5.625 3.938 N Pla2g6 n/a
7 TRCN0000182113 CGTATGAAGGACGAGGTGTTT pLKO.1 2243 CDS 100% 4.950 3.465 N Pla2g6 n/a
8 TRCN0000277534 CGTATGAAGGACGAGGTGTTT pLKO_005 2243 CDS 100% 4.950 3.465 N Pla2g6 n/a
9 TRCN0000182570 GCACACCAAGATGACAGATGT pLKO.1 2326 CDS 100% 4.950 3.465 N Pla2g6 n/a
10 TRCN0000277461 GCACACCAAGATGACAGATGT pLKO_005 2326 CDS 100% 4.950 3.465 N Pla2g6 n/a
11 TRCN0000178262 GTCGAAAGATAACATGGAGAT pLKO.1 1852 CDS 100% 4.050 2.835 N Pla2g6 n/a
12 TRCN0000182230 CTCCATGTCCATCTGACACTA pLKO.1 3085 3UTR 100% 4.950 2.970 N Pla2g6 n/a
13 TRCN0000277462 CTCCATGTCCATCTGACACTA pLKO_005 3085 3UTR 100% 4.950 2.970 N Pla2g6 n/a
14 TRCN0000051041 CGGCATCCAGTACTTCAGATT pLKO.1 2875 CDS 100% 4.950 3.465 N PLA2G6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.