Transcript: Mouse NM_001199265.1

Mus musculus erythrocyte membrane protein band 4.1 like 2 (Epb41l2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Epb41l2 (13822)
Length:
4389
CDS:
199..3165

Additional Resources:

NCBI RefSeq record:
NM_001199265.1
NBCI Gene record:
Epb41l2 (13822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306581 AGGAAACTCGTGACTAATTTA pLKO_005 3569 3UTR 100% 15.000 21.000 N Epb41l2 n/a
2 TRCN0000311604 TAGTGAACTCAAGCGCAATTT pLKO_005 2091 CDS 100% 13.200 18.480 N EPB41L2 n/a
3 TRCN0000375456 TTTGAGCGTGCCTCTAGTAAA pLKO_005 1792 CDS 100% 13.200 18.480 N Epb41l2 n/a
4 TRCN0000091206 CGACTCTCAGTTCTTAGAGAA pLKO.1 1347 CDS 100% 4.950 6.930 N Epb41l2 n/a
5 TRCN0000327110 CGACTCTCAGTTCTTAGAGAA pLKO_005 1347 CDS 100% 4.950 6.930 N Epb41l2 n/a
6 TRCN0000091203 GCGCAGTAATTTCTACATTAA pLKO.1 1530 CDS 100% 13.200 10.560 N Epb41l2 n/a
7 TRCN0000091204 CCAGAAGAATATGACAGTATT pLKO.1 1225 CDS 100% 13.200 9.240 N Epb41l2 n/a
8 TRCN0000091205 GCCAAGGGACAAGTGTTGTTT pLKO.1 889 CDS 100% 5.625 3.938 N Epb41l2 n/a
9 TRCN0000091207 CCAGAGATTATTTGTTGTTCA pLKO.1 2731 CDS 100% 4.950 3.465 N Epb41l2 n/a
10 TRCN0000327183 CCAGAGATTATTTGTTGTTCA pLKO_005 2731 CDS 100% 4.950 3.465 N Epb41l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199265.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.