Transcript: Human NM_001204054.2

Homo sapiens NADH:ubiquinone oxidoreductase subunit C2 (NDUFC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NDUFC2 (4718)
Length:
1911
CDS:
119..385

Additional Resources:

NCBI RefSeq record:
NM_001204054.2
NBCI Gene record:
NDUFC2 (4718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221401 GCTTCTATATATTACGGCCTT pLKO.1 298 CDS 100% 2.160 1.080 Y NDUFC2 n/a
2 TRCN0000025795 GCGGCTCCTCTACATCGGCTT pLKO.1 202 CDS 100% 0.000 0.000 Y NDUFC2 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1089 3UTR 100% 13.200 6.600 Y LIAS n/a
4 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 1547 3UTR 100% 4.950 2.475 Y C16orf89 n/a
5 TRCN0000221404 CCGGCCTGATTGATAACCTGA pLKO.1 237 CDS 100% 2.640 1.320 Y NDUFC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06624 pDONR223 100% 68.6% 66.3% None (many diffs) n/a
2 ccsbBroad304_06624 pLX_304 0% 68.6% 66.3% V5 (many diffs) n/a
Download CSV