Transcript: Human NM_001204269.2

Homo sapiens potassium voltage-gated channel subfamily A member 2 (KCNA2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
KCNA2 (3737)
Length:
1925
CDS:
542..1612

Additional Resources:

NCBI RefSeq record:
NM_001204269.2
NBCI Gene record:
KCNA2 (3737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044087 GCCTGCCAGGATTATAGCTAT pLKO.1 1021 CDS 100% 4.950 6.930 N KCNA2 n/a
2 TRCN0000044084 CCCAAAGAAACGAATGAGGTA pLKO.1 724 CDS 100% 2.640 2.112 N KCNA2 n/a
3 TRCN0000044086 CCTGTGAATGTGCCCTTAGAT pLKO.1 842 CDS 100% 5.625 3.938 N KCNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10930 pDONR223 100% 99.9% 100% None 219A>G n/a
2 ccsbBroad304_10930 pLX_304 0% 99.9% 100% V5 219A>G n/a
Download CSV