Transcript: Mouse NM_001204907.1

Mus musculus RecQ protein-like (Recql), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Recql (19691)
Length:
2163
CDS:
99..1994

Additional Resources:

NCBI RefSeq record:
NM_001204907.1
NBCI Gene record:
Recql (19691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001204907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328606 GCGTCTTTCAACCGGCCAAAT pLKO_005 933 CDS 100% 10.800 15.120 N Recql n/a
2 TRCN0000115248 GCTTGTCTTCTCAGCAACGAA pLKO.1 1824 CDS 100% 3.000 4.200 N Recql n/a
3 TRCN0000328682 ATGACTTCAGGCCTGATTATA pLKO_005 784 CDS 100% 15.000 10.500 N Recql n/a
4 TRCN0000115247 GCACGCTGAAATGGTGAATAA pLKO.1 617 CDS 100% 13.200 9.240 N Recql n/a
5 TRCN0000115249 GTGTGTTAATAGCACAGCATT pLKO.1 1462 CDS 100% 4.950 3.465 N Recql n/a
6 TRCN0000115250 GATGGTGTCATACTGCCAGAA pLKO.1 1424 CDS 100% 4.050 2.835 N Recql n/a
7 TRCN0000353430 GATGGTGTCATACTGCCAGAA pLKO_005 1424 CDS 100% 4.050 2.835 N Recql n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.