Transcript: Human NM_001205319.1

Homo sapiens nucleoredoxin (NXN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
NXN (64359)
Length:
2681
CDS:
62..1045

Additional Resources:

NCBI RefSeq record:
NM_001205319.1
NBCI Gene record:
NXN (64359)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303764 CGGCCTCCTGAGACGTTATTT pLKO_005 1054 3UTR 100% 15.000 21.000 N NXN n/a
2 TRCN0000064239 GCTCAAACTTTGGAACAAATA pLKO.1 97 CDS 100% 13.200 18.480 N NXN n/a
3 TRCN0000299746 GCTCAAACTTTGGAACAAATA pLKO_005 97 CDS 100% 13.200 18.480 N NXN n/a
4 TRCN0000064238 GCGTCTATTTCTCCGCACATT pLKO.1 327 CDS 100% 4.950 6.930 N NXN n/a
5 TRCN0000299815 GCGTCTATTTCTCCGCACATT pLKO_005 327 CDS 100% 4.950 6.930 N NXN n/a
6 TRCN0000064240 CCAACATTCCATCACTAATAT pLKO.1 126 CDS 100% 15.000 10.500 N NXN n/a
7 TRCN0000064241 GAATGACTTCCTAGCAGAGAA pLKO.1 1003 CDS 100% 4.950 3.465 N NXN n/a
8 TRCN0000310517 GAATGACTTCCTAGCAGAGAA pLKO_005 1003 CDS 100% 4.950 3.465 N NXN n/a
9 TRCN0000064242 CCTGGTGGAATCCTACCGGAA pLKO.1 379 CDS 100% 0.720 0.504 N NXN n/a
10 TRCN0000303765 GACTGACTCCCTGCGAGATTA pLKO_005 871 CDS 100% 13.200 7.920 N NXN n/a
11 TRCN0000114325 GTGAATGACTTCCTAGCAGAA pLKO.1 1001 CDS 100% 4.050 2.430 N Nxn n/a
12 TRCN0000345276 GTGAATGACTTCCTAGCAGAA pLKO_005 1001 CDS 100% 4.050 2.430 N Nxn n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2118 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2118 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.