Transcript: Human NM_001206850.2

Homo sapiens neuroligin 4 Y-linked (NLGN4Y), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
NLGN4Y (22829)
Length:
6757
CDS:
419..2365

Additional Resources:

NCBI RefSeq record:
NM_001206850.2
NBCI Gene record:
NLGN4Y (22829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075271 GCTATGGGAACGTCATCGTTA pLKO.1 489 CDS 100% 4.950 3.465 N NLGN4Y n/a
2 TRCN0000075268 GCCAGCCTGAACTATATTTAA pLKO.1 2934 3UTR 100% 15.000 7.500 Y NLGN4Y n/a
3 TRCN0000047124 CGAGATTATTCCACCGAATTA pLKO.1 1919 CDS 100% 13.200 6.600 Y NLGN4X n/a
4 TRCN0000047126 GCACAACTTGAACGAGATATT pLKO.1 1705 CDS 100% 13.200 6.600 Y NLGN4X n/a
5 TRCN0000047127 CGTCTGGGAATACTAGGGTTT pLKO.1 524 CDS 100% 4.050 2.025 Y NLGN4X n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.