Transcript: Human NM_001206927.2

Homo sapiens dynein axonemal heavy chain 8 (DNAH8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DNAH8 (1769)
Length:
14663
CDS:
140..14263

Additional Resources:

NCBI RefSeq record:
NM_001206927.2
NBCI Gene record:
DNAH8 (1769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163903 CGGATAAGTGAGCCCATCAAT pLKO.1 2369 CDS 100% 5.625 7.875 N DNAH8 n/a
2 TRCN0000161580 GCGAACTGATTTGACCTTCAT pLKO.1 14161 CDS 100% 4.950 6.930 N DNAH8 n/a
3 TRCN0000428850 AGATCGAACAGGTACTTATTG pLKO_005 1245 CDS 100% 13.200 10.560 N DNAH8 n/a
4 TRCN0000162616 CCAAGTTGTAAGGCTGTCATA pLKO.1 1376 CDS 100% 4.950 3.960 N DNAH8 n/a
5 TRCN0000414383 ACCTTGATGAATGCGATATTA pLKO_005 13065 CDS 100% 15.000 10.500 N DNAH8 n/a
6 TRCN0000159665 GCTGTATGTGTGTCCTATTTA pLKO.1 14128 CDS 100% 15.000 10.500 N DNAH8 n/a
7 TRCN0000158902 CCAGCCTTGGATAATGTATTA pLKO.1 11357 CDS 100% 13.200 9.240 N DNAH8 n/a
8 TRCN0000159104 GCTGTCATAAATGTGCTAAAT pLKO.1 1388 CDS 100% 13.200 9.240 N DNAH8 n/a
9 TRCN0000428496 TCTAGACCTATTCGTGATTTA pLKO_005 4118 CDS 100% 13.200 9.240 N DNAH8 n/a
10 TRCN0000161060 GCAGAGTAATTGCAGACAGAT pLKO.1 8868 CDS 100% 4.950 3.465 N DNAH8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.