Transcript: Mouse NM_001242368.1

Mus musculus coagulation factor X (F10), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
F10 (14058)
Length:
2693
CDS:
418..1899

Additional Resources:

NCBI RefSeq record:
NM_001242368.1
NBCI Gene record:
F10 (14058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001242368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423292 GCGGTTACTTCCTGGGTAATG pLKO_005 911 CDS 100% 10.800 15.120 N F10 n/a
2 TRCN0000031749 CGTGGTCATTAAGCACAACAA pLKO.1 1362 CDS 100% 4.950 3.960 N F10 n/a
3 TRCN0000031751 CCTGGGAAAGGTGTGTTTATT pLKO.1 511 CDS 100% 15.000 10.500 N F10 n/a
4 TRCN0000031750 CGAAAGAATACTGGACCAAAT pLKO.1 683 CDS 100% 10.800 7.560 N F10 n/a
5 TRCN0000435854 TCCCTTGACTTCATGGTATAC pLKO_005 2021 3UTR 100% 10.800 7.560 N F10 n/a
6 TRCN0000031753 CCAGTCGAACATCCTGAAGAT pLKO.1 1560 CDS 100% 4.950 3.465 N F10 n/a
7 TRCN0000031752 GAAAGGGAAATATGGCATCTA pLKO.1 1779 CDS 100% 4.950 3.465 N F10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.