Transcript: Human NM_001242460.1

Homo sapiens growth hormone receptor (GHR), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GHR (2690)
Length:
4316
CDS:
12..1862

Additional Resources:

NCBI RefSeq record:
NM_001242460.1
NBCI Gene record:
GHR (2690)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058847 GCCATTCATGATAGCTATAAA pLKO.1 924 CDS 100% 15.000 21.000 N GHR n/a
2 TRCN0000445521 TGTGACATGCACCCGGAAATG pLKO_005 1485 CDS 100% 10.800 15.120 N GHR n/a
3 TRCN0000058846 GCACCACGCAATGCAGATATT pLKO.1 474 CDS 100% 13.200 10.560 N GHR n/a
4 TRCN0000438271 CTCACCAAGCTGCCCATATTC pLKO_005 1345 CDS 100% 13.200 9.240 N GHR n/a
5 TRCN0000431190 TCTTCTAAGGAGCCTAAATTC pLKO_005 84 CDS 100% 13.200 9.240 N GHR n/a
6 TRCN0000058843 CCAGACTATACCTCCATTCAT pLKO.1 1722 CDS 100% 5.625 3.938 N GHR n/a
7 TRCN0000058844 CCATCTGGATACCTTATTGTA pLKO.1 304 CDS 100% 5.625 3.938 N GHR n/a
8 TRCN0000058845 GCTCCTCACATCAAGGTTGAA pLKO.1 1584 CDS 100% 4.950 3.465 N GHR n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3619 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3619 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.