Transcript: Human NM_001242787.1

Homo sapiens BRF1 RNA polymerase III transcription initiation factor subunit (BRF1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
BRF1 (2972)
Length:
3386
CDS:
418..2106

Additional Resources:

NCBI RefSeq record:
NM_001242787.1
NBCI Gene record:
BRF1 (2972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221668 TGCCTGTATATTCCACGCTTT pLKO.1 622 CDS 100% 4.050 5.670 N BRF1 n/a
2 TRCN0000221667 CAGGTGAATGTGTACGTGCTT pLKO.1 541 CDS 100% 2.640 3.696 N BRF1 n/a
3 TRCN0000430265 GAGGAGGTTGAAGGTGAAATA pLKO_005 1015 CDS 100% 13.200 9.240 N BRF1 n/a
4 TRCN0000420420 CCAGTTACCAGGATGCAATTG pLKO_005 1037 CDS 100% 10.800 7.560 N BRF1 n/a
5 TRCN0000420635 TGATGGGCAGCAACGACTATG pLKO_005 2054 CDS 100% 10.800 7.560 N BRF1 n/a
6 TRCN0000431361 TTGACAGGTACATCCTGAATG pLKO_005 1442 CDS 100% 10.800 7.560 N BRF1 n/a
7 TRCN0000221664 CCATTGGGATTGTGTTTCTAT pLKO.1 2263 3UTR 100% 5.625 3.938 N BRF1 n/a
8 TRCN0000221665 CGGCATCTACAAGGAACACAA pLKO.1 1566 CDS 100% 4.950 3.465 N BRF1 n/a
9 TRCN0000221666 GCTTGAACAAGTCCTGTCAAA pLKO.1 987 CDS 100% 4.950 2.970 N BRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242787.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.