Transcript: Mouse NM_001242945.1

Mus musculus predicted gene 3264 (Gm3264), mRNA.

Source:
NCBI, updated 2017-05-10
Taxon:
Mus musculus (mouse)
Gene:
Gm3264 (100041306)
Length:
519
CDS:
1..519

Additional Resources:

NCBI RefSeq record:
NM_001242945.1
NBCI Gene record:
Gm3264 (100041306)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001242945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270541 ATGAACTAGAAGAACTGAAAT pLKO_005 26 CDS 100% 13.200 6.600 Y Gm5796 n/a
2 TRCN0000284416 ACGTAAGGATATTACTGAATG pLKO_005 308 CDS 100% 10.800 5.400 Y Gm5796 n/a
3 TRCN0000270542 ACTGATAGAAGATAACTATTC pLKO_005 234 CDS 100% 10.800 5.400 Y Gm5796 n/a
4 TRCN0000198693 CAGCAATGACATGGAGGAAAT pLKO.1 63 CDS 100% 10.800 5.400 Y Gm5797 n/a
5 TRCN0000197374 CGTTTACATGTATGAGGATTT pLKO.1 99 CDS 100% 10.800 5.400 Y Gm5797 n/a
6 TRCN0000197550 CCAAGGAACTGATAGAAGATA pLKO.1 227 CDS 100% 5.625 2.813 Y Gm10128 n/a
7 TRCN0000177036 GAAGACAATGTTGGATATGAA pLKO.1 168 CDS 100% 5.625 2.813 Y Gm10128 n/a
8 TRCN0000192499 GCAATGACATGGAGGAAATGT pLKO.1 65 CDS 100% 5.625 2.813 Y Gm5796 n/a
9 TRCN0000192160 CACAACATGAGAAGACAATGT pLKO.1 158 CDS 100% 4.950 2.475 Y Gm3696 n/a
10 TRCN0000192274 CAGTACTCCAAGGAACTGATA pLKO.1 220 CDS 100% 4.950 2.475 Y Gm10128 n/a
11 TRCN0000177971 GAGGAAGATCAGCAATGACAT pLKO.1 54 CDS 100% 4.950 2.475 Y Gm10128 n/a
12 TRCN0000177037 GATAACTATTCCTACAGCATT pLKO.1 244 CDS 100% 4.950 2.475 Y Gm10128 n/a
13 TRCN0000182285 GCAGTACTCCAAGGAACTGAT pLKO.1 219 CDS 100% 4.950 2.475 Y D830030K20Rik n/a
14 TRCN0000202051 CATGCAGTACTCCAAGGAACT pLKO.1 216 CDS 100% 4.050 2.025 Y Gm10128 n/a
15 TRCN0000198181 CCAGTCCATAATTGGTTCCAT pLKO.1 198 CDS 100% 3.000 1.500 Y Gm10128 n/a
16 TRCN0000191015 CTAGAAGAACTGAAATTGGAT pLKO.1 31 CDS 100% 3.000 1.500 Y Gm5796 n/a
17 TRCN0000190046 GACATGGAGGAAATGTGTGGA pLKO.1 70 CDS 100% 2.640 1.320 Y Gm3696 n/a
18 TRCN0000201827 GTCCATAATTGGTTCCATGCA pLKO.1 201 CDS 100% 2.640 1.320 Y Gm3696 n/a
19 TRCN0000200182 CTACAGCATTAAGGAGGACCA pLKO.1 255 CDS 100% 2.160 1.080 Y D830030K20Rik n/a
20 TRCN0000196168 GAATGAGAACAGAAGGCTGCT pLKO.1 324 CDS 100% 2.160 1.080 Y 2610042L04Rik n/a
21 TRCN0000189809 GATCAGCAATGACATGGAGGA pLKO.1 60 CDS 100% 2.160 1.080 Y Gm10128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.