Transcript: Mouse NM_001243043.1

Mus musculus adaptor protein complex AP-1, beta 1 subunit (Ap1b1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ap1b1 (11764)
Length:
4336
CDS:
452..3313

Additional Resources:

NCBI RefSeq record:
NM_001243043.1
NBCI Gene record:
Ap1b1 (11764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379738 GTCCTCTGGGTGCCAATATTA pLKO_005 3698 3UTR 100% 15.000 12.000 N Ap1b1 n/a
2 TRCN0000100550 GCACATTTCTTCCCTCTACAA pLKO.1 4105 3UTR 100% 4.950 3.960 N Ap1b1 n/a
3 TRCN0000100553 CCAGTTCAATCGTAACAGCTT pLKO.1 2755 CDS 100% 2.640 2.112 N Ap1b1 n/a
4 TRCN0000324560 CCAGTTCAATCGTAACAGCTT pLKO_005 2755 CDS 100% 2.640 2.112 N Ap1b1 n/a
5 TRCN0000379952 TGTCTCCTCCCAGAGTGAAAT pLKO_005 3467 3UTR 100% 13.200 9.240 N Ap1b1 n/a
6 TRCN0000381887 TCCAGACCAAGGTCAACTATG pLKO_005 1647 CDS 100% 10.800 7.560 N AP1B1 n/a
7 TRCN0000100551 CCAGAGATCTTGAAGCATGAA pLKO.1 1391 CDS 100% 4.950 3.465 N Ap1b1 n/a
8 TRCN0000324559 CCAGAGATCTTGAAGCATGAA pLKO_005 1391 CDS 100% 4.950 3.465 N Ap1b1 n/a
9 TRCN0000100554 CTGCGCAACATCAATCTCATT pLKO.1 1358 CDS 100% 4.950 3.465 N Ap1b1 n/a
10 TRCN0000324561 CTGCGCAACATCAATCTCATT pLKO_005 1358 CDS 100% 4.950 3.465 N Ap1b1 n/a
11 TRCN0000100552 GCCAGGATATGCTCTACCAAT pLKO.1 3138 CDS 100% 4.950 3.465 N Ap1b1 n/a
12 TRCN0000324482 GCCAGGATATGCTCTACCAAT pLKO_005 3138 CDS 100% 4.950 3.465 N Ap1b1 n/a
13 TRCN0000381335 GTCAGCCTGACATGGCCATTA pLKO_005 687 CDS 100% 10.800 6.480 N AP1B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.