Transcript: Mouse NM_001243138.1

Mus musculus zinc finger protein 981 (Zfp981), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp981 (100041433)
Length:
3068
CDS:
293..1630

Additional Resources:

NCBI RefSeq record:
NM_001243138.1
NBCI Gene record:
Zfp981 (100041433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 1748 3UTR 100% 15.000 7.500 Y Gm13212 n/a
2 TRCN0000240280 CTCCGAAAGTACACCTTATAA pLKO_005 580 CDS 100% 15.000 7.500 Y Zfp600 n/a
3 TRCN0000240278 GCATGTTCTTAATCCTATAAT pLKO_005 2867 3UTR 100% 15.000 7.500 Y Zfp600 n/a
4 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 1747 3UTR 100% 15.000 7.500 Y Zfp984 n/a
5 TRCN0000429213 AGGAATGGGAATGTCTCAATT pLKO_005 366 CDS 100% 13.200 6.600 Y Rex2 n/a
6 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 993 CDS 100% 13.200 6.600 Y Znf41-ps n/a
7 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 993 CDS 100% 13.200 6.600 Y EG666605 n/a
8 TRCN0000084461 CCTCCGAAAGTACACCTTATA pLKO.1 579 CDS 100% 13.200 6.600 Y Rex2 n/a
9 TRCN0000015352 CGGGAGAGAAACCTTACAAAT pLKO.1 1077 CDS 100% 13.200 6.600 Y ZNF85 n/a
10 TRCN0000416415 CTTACACTTGTGGTGAATTTG pLKO_005 840 CDS 100% 13.200 6.600 Y Rex2 n/a
11 TRCN0000273018 TCCGAAAGTACACCTTATAAC pLKO_005 581 CDS 100% 13.200 6.600 Y Zfp980 n/a
12 TRCN0000418910 ACCTTACAAATGTAGTGAATG pLKO_005 1003 CDS 100% 10.800 5.400 Y Rex2 n/a
13 TRCN0000431060 ATGTAGTGAATGCGACAAATG pLKO_005 1012 CDS 100% 10.800 5.400 Y Rex2 n/a
14 TRCN0000084462 CCAGGAAAGAAATCTTACAAA pLKO.1 908 CDS 100% 5.625 2.813 Y Rex2 n/a
15 TRCN0000084460 CCCATCTTAGTATTCATCATA pLKO.1 963 CDS 100% 5.625 2.813 Y Rex2 n/a
16 TRCN0000084458 GCACATATAAAGACTGTGTAA pLKO.1 675 CDS 100% 4.950 2.475 Y Rex2 n/a
17 TRCN0000284909 TGTAATGAATGTGACAAATTC pLKO_005 1601 CDS 100% 13.200 6.600 Y Zfp980 n/a
18 TRCN0000240279 GTCAATGAGCATGGGCATAAC pLKO_005 509 CDS 100% 10.800 5.400 Y Zfp600 n/a
19 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 1004 CDS 100% 13.200 6.600 Y Gm13212 n/a
20 TRCN0000240204 ATACGGGAGAGAAACCTTATG pLKO_005 1074 CDS 100% 10.800 5.400 Y EG665449 n/a
21 TRCN0000421009 ATCCCATCTTAGTATTCATTG pLKO_005 1633 3UTR 100% 10.800 5.400 Y Rex2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.