Transcript: Human NM_001243650.2

Homo sapiens glucose-fructose oxidoreductase domain containing 2 (GFOD2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GFOD2 (81577)
Length:
5521
CDS:
242..580

Additional Resources:

NCBI RefSeq record:
NM_001243650.2
NBCI Gene record:
GFOD2 (81577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064368 GACATCTTGCTGCATCAAGAT pLKO.1 416 CDS 100% 0.495 0.347 N GFOD2 n/a
2 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3805 3UTR 100% 10.800 5.400 Y SMIM11A n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1501 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1336 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1501 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.