Transcript: Mouse NM_001243712.1

Mus musculus itchy, E3 ubiquitin protein ligase (Itch), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Itch (16396)
Length:
5389
CDS:
406..3000

Additional Resources:

NCBI RefSeq record:
NM_001243712.1
NBCI Gene record:
Itch (16396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431248 TGCCTGTTGCACATCTTATTG pLKO_005 3065 3UTR 100% 13.200 18.480 N Itch n/a
2 TRCN0000414505 TGGACAATATGGGACGTATTT pLKO_005 1391 CDS 100% 13.200 18.480 N Itch n/a
3 TRCN0000412287 GACATCTCGGAAACGCAATAC pLKO_005 3354 3UTR 100% 10.800 15.120 N Itch n/a
4 TRCN0000026908 CCCTACGAGTAAATTATGTTT pLKO.1 627 CDS 100% 5.625 7.875 N Itch n/a
5 TRCN0000026925 CCACCTGAAATACTTTCGTTT pLKO.1 2187 CDS 100% 4.950 6.930 N Itch n/a
6 TRCN0000026914 GCGAAGGAATTAGAGGTTCTT pLKO.1 2611 CDS 100% 4.950 3.960 N Itch n/a
7 TRCN0000416646 AGTTACCTGAGAGTAAGTAAA pLKO_005 3108 3UTR 100% 13.200 9.240 N Itch n/a
8 TRCN0000026903 CCAGGAGAAGAAGGTTTAGAT pLKO.1 2032 CDS 100% 5.625 3.938 N Itch n/a
9 TRCN0000026905 GCAGCAGTTTAACCAGAGATT pLKO.1 1521 CDS 100% 4.950 3.465 N Itch n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.