Transcript: Human NM_001243728.1

Homo sapiens ATP synthase mitochondrial F1 complex assembly factor 1 (ATPAF1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ATPAF1 (64756)
Length:
1710
CDS:
231..953

Additional Resources:

NCBI RefSeq record:
NM_001243728.1
NBCI Gene record:
ATPAF1 (64756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045863 CCATCAGGTTAAAGACTTCAT pLKO.1 1454 3UTR 100% 4.950 3.960 N ATPAF1 n/a
2 TRCN0000436536 TTTAAGTGTTCGAGGTTATAA pLKO_005 1181 3UTR 100% 15.000 10.500 N ATPAF1 n/a
3 TRCN0000420928 AGATACAGTCTACGCAGTTAT pLKO_005 482 CDS 100% 13.200 9.240 N ATPAF1 n/a
4 TRCN0000435301 GACTTGGAGCAGAACTGAAAT pLKO_005 907 CDS 100% 13.200 9.240 N ATPAF1 n/a
5 TRCN0000428934 ATGTCTGTCATCGCTGAATTG pLKO_005 876 CDS 100% 10.800 7.560 N ATPAF1 n/a
6 TRCN0000045865 CCTCAGACCAAATGAGTTCAA pLKO.1 851 CDS 100% 4.950 3.465 N ATPAF1 n/a
7 TRCN0000045866 CAGAGGATTCACTAAGGACAA pLKO.1 371 CDS 100% 4.050 2.835 N ATPAF1 n/a
8 TRCN0000045864 CCTGGAGAAACGCAGTGAATT pLKO.1 260 CDS 100% 0.000 0.000 N ATPAF1 n/a
9 TRCN0000045867 GCAGAAATGGATTCCACATTT pLKO.1 735 CDS 100% 1.320 0.792 N ATPAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.