Transcript: Human NM_001243900.2

Homo sapiens high density lipoprotein binding protein (HDLBP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
HDLBP (3069)
Length:
6301
CDS:
252..3959

Additional Resources:

NCBI RefSeq record:
NM_001243900.2
NBCI Gene record:
HDLBP (3069)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153864 CGGTGCCAACATAAACAGAAT pLKO.1 1514 CDS 100% 4.950 6.930 N HDLBP n/a
2 TRCN0000155065 GCGGTGCCAACATAAACAGAA pLKO.1 1513 CDS 100% 4.950 6.930 N HDLBP n/a
3 TRCN0000292471 GCGGTGCCAACATAAACAGAA pLKO_005 1513 CDS 100% 4.950 6.930 N HDLBP n/a
4 TRCN0000153797 CCGTAAATTGTTGACGCTCTT pLKO.1 4050 3UTR 100% 4.050 5.670 N HDLBP n/a
5 TRCN0000154305 CCGTTACGTTATTGGGCAGAA pLKO.1 3104 CDS 100% 4.050 5.670 N HDLBP n/a
6 TRCN0000297988 CCGTTACGTTATTGGGCAGAA pLKO_005 3104 CDS 100% 4.050 5.670 N HDLBP n/a
7 TRCN0000154197 CCATCGCTTTGTTATTGGCAA pLKO.1 842 CDS 100% 2.640 3.696 N HDLBP n/a
8 TRCN0000151220 GCTCGCATCAAGAAGATTTAT pLKO.1 1203 CDS 100% 15.000 12.000 N HDLBP n/a
9 TRCN0000150941 GCTCCACTGTTTAACACTAAA pLKO.1 4158 3UTR 100% 13.200 9.240 N HDLBP n/a
10 TRCN0000154388 CCAGCAGATTACTCGGGATTT pLKO.1 2840 CDS 100% 10.800 7.560 N HDLBP n/a
11 TRCN0000292468 CCAGCAGATTACTCGGGATTT pLKO_005 2840 CDS 100% 10.800 7.560 N HDLBP n/a
12 TRCN0000153823 CGTTACGTTATTGGGCAGAAA pLKO.1 3105 CDS 100% 4.950 3.465 N HDLBP n/a
13 TRCN0000154928 GCCAAGCCAGAATACCACAAA pLKO.1 2352 CDS 100% 4.950 3.465 N HDLBP n/a
14 TRCN0000292469 GCCAAGCCAGAATACCACAAA pLKO_005 2352 CDS 100% 4.950 3.465 N HDLBP n/a
15 TRCN0000154496 GCATGACGTGAACATCCAGTT pLKO.1 3395 CDS 100% 4.050 2.835 N HDLBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243900.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.