Transcript: Human NM_001244008.1

Homo sapiens kinesin family member 1A (KIF1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
KIF1A (547)
Length:
9233
CDS:
248..5623

Additional Resources:

NCBI RefSeq record:
NM_001244008.1
NBCI Gene record:
KIF1A (547)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271454 CATGACGCAGAGACCAATATC pLKO_005 935 CDS 100% 13.200 18.480 N KIF1A n/a
2 TRCN0000271501 TCCAGCATCTCTGCCGAATAT pLKO_005 3578 CDS 100% 13.200 18.480 N KIF1A n/a
3 TRCN0000271502 CCCTTCAATTCCCGGGAAATG pLKO_005 287 CDS 100% 10.800 15.120 N KIF1A n/a
4 TRCN0000117005 CGCTTATATCGAGATGGAGAA pLKO.1 4357 CDS 100% 4.050 5.670 N KIF1A n/a
5 TRCN0000117006 CCGCTTATATCGAGATGGAGA pLKO.1 4356 CDS 100% 2.640 3.696 N KIF1A n/a
6 TRCN0000284394 GGTTCTTGCTGCCGTTCTAAT pLKO_005 5893 3UTR 100% 13.200 9.240 N KIF1A n/a
7 TRCN0000271500 GTGACTCCAAGTGCATCATTC pLKO_005 312 CDS 100% 10.800 7.560 N KIF1A n/a
8 TRCN0000117002 GCTGAGAAGATGCCAATGTTT pLKO.1 8694 3UTR 100% 5.625 3.938 N KIF1A n/a
9 TRCN0000117004 CGGACCCAACAAGAACAAGAA pLKO.1 1117 CDS 100% 4.950 3.465 N KIF1A n/a
10 TRCN0000117003 CGGTAACTCAAGGACAGCTAT pLKO.1 1207 CDS 100% 4.950 3.465 N KIF1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.