Transcript: Human NM_001244898.1

Homo sapiens polypyrimidine tract binding protein 3 (PTBP3), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
PTBP3 (9991)
Length:
8009
CDS:
184..1860

Additional Resources:

NCBI RefSeq record:
NM_001244898.1
NBCI Gene record:
PTBP3 (9991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244898.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061787 CCAAGGTCTGACTAAGGATTT pLKO.1 1533 CDS 100% 10.800 15.120 N PTBP3 n/a
2 TRCN0000315701 CCAAGGTCTGACTAAGGATTT pLKO_005 1533 CDS 100% 10.800 15.120 N PTBP3 n/a
3 TRCN0000061786 CCATGAATAGTTCTACTCCTT pLKO.1 293 CDS 100% 2.640 3.696 N PTBP3 n/a
4 TRCN0000061784 CCAGCCTTAATGTGAAATATA pLKO.1 977 CDS 100% 15.000 10.500 N PTBP3 n/a
5 TRCN0000310717 GAGCCCTGTGCTTCGAATAAT pLKO_005 735 CDS 100% 15.000 10.500 N PTBP3 n/a
6 TRCN0000061783 GCCGTTACTATGGTGAATTAT pLKO.1 520 CDS 100% 15.000 10.500 N PTBP3 n/a
7 TRCN0000310715 TTTGGTGCACCGGGTATAATT pLKO_005 1084 CDS 100% 15.000 10.500 N PTBP3 n/a
8 TRCN0000338854 CAGTATGCTGACCCAGTAAAT pLKO_005 874 CDS 100% 13.200 9.240 N PTBP3 n/a
9 TRCN0000303472 GATCAGCCTTATACAACATTT pLKO_005 2190 3UTR 100% 13.200 9.240 N PTBP3 n/a
10 TRCN0000338794 TTAGATTTGAAGAGGATTAAC pLKO_005 2149 3UTR 100% 13.200 9.240 N PTBP3 n/a
11 TRCN0000061785 CCTCAGAGTTTCCTTCTCAAA pLKO.1 1827 CDS 100% 4.950 3.465 N PTBP3 n/a
12 TRCN0000306570 CCATTTGGCAAAGTAACTAAT pLKO_005 442 CDS 100% 13.200 7.920 N Ptbp3 n/a
13 TRCN0000338925 CCATTTGGCAAAGTAACTAAT pLKO_005 442 CDS 100% 13.200 7.920 N PTBP3 n/a
14 TRCN0000348546 TTTGGTGCACCGGGTATAATG pLKO_005 1084 CDS 100% 13.200 9.240 N Ptbp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244898.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11442 pDONR223 100% 100% 100% None n/a
Download CSV