Transcript: Human NM_001247987.2

Homo sapiens synaptotagmin 13 (SYT13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SYT13 (57586)
Length:
5383
CDS:
785..1633

Additional Resources:

NCBI RefSeq record:
NM_001247987.2
NBCI Gene record:
SYT13 (57586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001247987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379766 GGAACGAGATGATCATGTTTG pLKO_005 1419 CDS 100% 10.800 15.120 N Syt13 n/a
2 TRCN0000059477 CTCCTGGTGGTGCTGATTAAA pLKO.1 1262 CDS 100% 15.000 10.500 N SYT13 n/a
3 TRCN0000307847 CTCCTGGTGGTGCTGATTAAA pLKO_005 1262 CDS 100% 15.000 10.500 N SYT13 n/a
4 TRCN0000381800 AGCTGGAGAGGTCCTACTATC pLKO_005 1213 CDS 100% 10.800 7.560 N SYT13 n/a
5 TRCN0000059473 GCTGAAGAAGAAGCAGACTAA pLKO.1 1369 CDS 100% 4.950 3.465 N SYT13 n/a
6 TRCN0000291916 GCTGAAGAAGAAGCAGACTAA pLKO_005 1369 CDS 100% 4.950 3.465 N SYT13 n/a
7 TRCN0000059476 CAGACTATTCACTGAGGTCTA pLKO.1 645 5UTR 100% 4.050 2.835 N SYT13 n/a
8 TRCN0000310156 CAGACTATTCACTGAGGTCTA pLKO_005 645 5UTR 100% 4.050 2.835 N SYT13 n/a
9 TRCN0000059474 CCTGGACTATGACTGTCAGAA pLKO.1 847 CDS 100% 4.950 2.970 N SYT13 n/a
10 TRCN0000307850 CCTGGACTATGACTGTCAGAA pLKO_005 847 CDS 100% 4.950 2.970 N SYT13 n/a
11 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 3353 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001247987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.