Transcript: Mouse NM_001252452.1

Mus musculus POU domain, class 5, transcription factor 1 (Pou5f1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Pou5f1 (18999)
Length:
991
CDS:
100..765

Additional Resources:

NCBI RefSeq record:
NM_001252452.1
NBCI Gene record:
Pou5f1 (18999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009612 CCTACAGCAGATCACTCACAT pLKO.1 453 CDS 100% 4.950 3.465 N Pou5f1 n/a
2 TRCN0000009613 CGTTCTCTTTGGAAAGGTGTT pLKO.1 201 CDS 100% 4.050 2.835 N Pou5f1 n/a
3 TRCN0000009611 GCCGACAACAATGAGAACCTT pLKO.1 316 CDS 100% 3.000 2.100 N Pou5f1 n/a
4 TRCN0000235526 GGCTCTCCCATGCATTCAAAC pLKO_005 742 CDS 100% 10.800 5.400 Y POU5F1 n/a
5 TRCN0000009615 CAAGGGAGGTAGACAAGAGAA pLKO.1 802 3UTR 100% 4.950 2.475 Y Pou5f1 n/a
6 TRCN0000430010 CCACTTCACCACACTCTACTC pLKO_005 669 CDS 100% 4.050 2.025 Y Pou5f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15533 pDONR223 0% 52.2% 54.1% None (many diffs) n/a
2 ccsbBroad304_15533 pLX_304 0% 52.2% 54.1% V5 (many diffs) n/a
3 ccsbBroadEn_06753 pDONR223 100% 52.1% 54.1% None (many diffs) n/a
4 TRCN0000475990 CATTGATAAATCCGGTTCGTAGAA pLX_317 36.6% 52.1% 54.1% V5 (many diffs) n/a
Download CSV