Transcript: Mouse NM_001252495.1

Mus musculus retinoblastoma binding protein 8, endonuclease (Rbbp8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rbbp8 (225182)
Length:
3523
CDS:
348..3029

Additional Resources:

NCBI RefSeq record:
NM_001252495.1
NBCI Gene record:
Rbbp8 (225182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305374 ACGGCTGTTGTAGTCTATAAT pLKO_005 3316 3UTR 100% 15.000 21.000 N Rbbp8 n/a
2 TRCN0000305311 ACTTAAGCAAGCCACTATTTA pLKO_005 1889 CDS 100% 15.000 12.000 N Rbbp8 n/a
3 TRCN0000088050 GCAAGGTTTACAAGTCAAAGT pLKO.1 452 CDS 100% 4.950 3.960 N Rbbp8 n/a
4 TRCN0000331925 GCAAGGTTTACAAGTCAAAGT pLKO_005 452 CDS 100% 4.950 3.960 N Rbbp8 n/a
5 TRCN0000305376 ATCCGACAGCAGAACCTTAAG pLKO_005 672 CDS 100% 10.800 7.560 N Rbbp8 n/a
6 TRCN0000305310 GATAGCAGTCACTCACGATTA pLKO_005 2370 CDS 100% 10.800 7.560 N Rbbp8 n/a
7 TRCN0000088051 GCATCCAATGACTTCAAGGAA pLKO.1 393 CDS 100% 3.000 2.100 N Rbbp8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.