Transcript: Mouse NM_001252629.1

Mus musculus survival motor neuron 1 (Smn1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Smn1 (20595)
Length:
1291
CDS:
686..970

Additional Resources:

NCBI RefSeq record:
NM_001252629.1
NBCI Gene record:
Smn1 (20595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072021 CGACCTGTGAAGTAGCTAATA pLKO.1 525 5UTR 100% 13.200 10.560 N Smn1 n/a
2 TRCN0000302265 CGACCTGTGAAGTAGCTAATA pLKO_005 525 5UTR 100% 13.200 10.560 N Smn1 n/a
3 TRCN0000072019 CCCTTGAAACAGTGGAAAGTT pLKO.1 356 5UTR 100% 5.625 3.938 N Smn1 n/a
4 TRCN0000302194 CCCTTGAAACAGTGGAAAGTT pLKO_005 356 5UTR 100% 5.625 3.938 N Smn1 n/a
5 TRCN0000072020 CCATTGACTTTAAGAGAGAAA pLKO.1 438 5UTR 100% 4.950 3.465 N Smn1 n/a
6 TRCN0000302193 CCATTGACTTTAAGAGAGAAA pLKO_005 438 5UTR 100% 4.950 3.465 N Smn1 n/a
7 TRCN0000072018 GCTCTAAAGAACGGTGACATT pLKO.1 251 5UTR 100% 4.950 3.465 N Smn1 n/a
8 TRCN0000302264 GCTCTAAAGAACGGTGACATT pLKO_005 251 5UTR 100% 4.950 3.465 N Smn1 n/a
9 TRCN0000072022 CTCTTGGTACATGAGTGGCTA pLKO.1 883 CDS 100% 2.640 1.848 N Smn1 n/a
10 TRCN0000302192 CTCTTGGTACATGAGTGGCTA pLKO_005 883 CDS 100% 2.640 1.848 N Smn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.