Transcript: Mouse NM_001253758.1

Mus musculus acidic (leucine-rich) nuclear phosphoprotein 32 family, member E (Anp32e), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Anp32e (66471)
Length:
2904
CDS:
341..754

Additional Resources:

NCBI RefSeq record:
NM_001253758.1
NBCI Gene record:
Anp32e (66471)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253758.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077253 GCGATCACATTGTCTTTGTTT pLKO.1 797 3UTR 100% 5.625 4.500 N Anp32e n/a
2 TRCN0000311769 GCGATCACATTGTCTTTGTTT pLKO_005 797 3UTR 100% 5.625 4.500 N Anp32e n/a
3 TRCN0000312815 ACTTAATGAAAGACGAAATTC pLKO_005 606 CDS 100% 13.200 9.240 N Anp32e n/a
4 TRCN0000077936 CCTCTCATACTTAATGAAAGA pLKO.1 598 CDS 100% 4.950 3.465 N ANP32E n/a
5 TRCN0000333036 CCTCTCATACTTAATGAAAGA pLKO_005 598 CDS 100% 4.950 3.465 N ANP32E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253758.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.