Transcript: Human NM_001253775.2

Homo sapiens cAMP responsive element binding protein 3 like 2 (CREB3L2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CREB3L2 (64764)
Length:
1131
CDS:
382..1128

Additional Resources:

NCBI RefSeq record:
NM_001253775.2
NBCI Gene record:
CREB3L2 (64764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001253775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274872 TCCTCGTGCCAGACCATTATT pLKO_005 883 CDS 100% 15.000 10.500 N CREB3L2 n/a
2 TRCN0000016441 TCAGAACTTCTGGATGAGTTT pLKO.1 490 CDS 100% 4.950 3.465 N CREB3L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12485 pDONR223 100% 99.5% 99.5% None 295_297delACC n/a
2 ccsbBroad304_12485 pLX_304 0% 99.5% 99.5% V5 295_297delACC n/a
Download CSV