Transcript: Human NM_001254727.1

Homo sapiens adaptor related protein complex 4 subunit sigma 1 (AP4S1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
AP4S1 (11154)
Length:
1926
CDS:
390..839

Additional Resources:

NCBI RefSeq record:
NM_001254727.1
NBCI Gene record:
AP4S1 (11154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001254727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381226 TTTATAAGGTCCCTAGATATC pLKO_005 1337 3UTR 100% 10.800 15.120 N AP4S1 n/a
2 TRCN0000380894 TTTCCACAGTACTTGGCAAAT pLKO_005 716 CDS 100% 10.800 15.120 N AP4S1 n/a
3 TRCN0000059843 CGAGTGAGTGAATTAGATGTA pLKO.1 678 CDS 100% 4.950 6.930 N AP4S1 n/a
4 TRCN0000381990 ATGAGTATTTCAGCCGAGTGA pLKO_005 664 CDS 100% 2.640 3.696 N AP4S1 n/a
5 TRCN0000381699 ACCAATGAACAGCACAGTATG pLKO_005 1008 3UTR 100% 10.800 7.560 N AP4S1 n/a
6 TRCN0000379452 CAAATGCACTCTGGTCCTTAT pLKO_005 732 CDS 100% 10.800 7.560 N AP4S1 n/a
7 TRCN0000379984 TCTCCAGACAGTTCATCATTC pLKO_005 938 3UTR 100% 10.800 7.560 N AP4S1 n/a
8 TRCN0000059847 CCAGACAGTTCATCATTCAAA pLKO.1 941 3UTR 100% 5.625 3.938 N AP4S1 n/a
9 TRCN0000059846 CGACTTTCTAAGTACTATGAA pLKO.1 432 CDS 100% 5.625 3.938 N AP4S1 n/a
10 TRCN0000059845 GCAAATGCACTCTGGTCCTTA pLKO.1 731 CDS 100% 4.950 3.465 N AP4S1 n/a
11 TRCN0000059844 CGAGATGGCTATTTATGAATT pLKO.1 617 CDS 100% 0.000 0.000 N AP4S1 n/a
12 TRCN0000379910 AGTGAGTGAATTAGATGTATC pLKO_005 680 CDS 100% 10.800 6.480 N AP4S1 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 859 3UTR 100% 2.640 1.320 Y LINC01098 n/a
14 TRCN0000113121 GCCGAGTGAGTGAATTAGATA pLKO.1 676 CDS 100% 5.625 4.500 N Ap4s1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001254727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.