Transcript: Human NM_001254734.2

Homo sapiens transglutaminase 6 (TGM6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TGM6 (343641)
Length:
2165
CDS:
69..1946

Additional Resources:

NCBI RefSeq record:
NM_001254734.2
NBCI Gene record:
TGM6 (343641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001254734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056295 TGGGCGAGTTTGTTCTCCTTT pLKO.1 454 CDS 100% 4.950 6.930 N TGM6 n/a
2 TRCN0000056293 GCGTGTATACTCAAACACGAA pLKO.1 1301 CDS 100% 0.264 0.370 N TGM6 n/a
3 TRCN0000420850 GAACCTGAGTGTGGACAAATA pLKO_005 986 CDS 100% 13.200 9.240 N TGM6 n/a
4 TRCN0000419392 TCACTGACCTCTACAAGTATC pLKO_005 1378 CDS 100% 10.800 7.560 N TGM6 n/a
5 TRCN0000056294 GCCGCAAGAAGAGAAGAGAAT pLKO.1 1736 CDS 100% 4.950 3.465 N TGM6 n/a
6 TRCN0000056296 GTGGAGAAGGACATTACTCTA pLKO.1 1860 CDS 100% 4.950 3.465 N TGM6 n/a
7 TRCN0000431064 TGTACAGCAAGGCGGTGAACA pLKO_005 1426 CDS 100% 4.950 3.465 N TGM6 n/a
8 TRCN0000415561 TTCGTGTTTGCGGAGGTCAAC pLKO_005 1236 CDS 100% 4.050 2.835 N TGM6 n/a
9 TRCN0000056297 CGAGGCGTGGAGAAGCACATA pLKO.1 564 CDS 100% 1.650 1.155 N TGM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001254734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.