Transcript: Mouse NM_001254761.1

Mus musculus ring finger protein 128 (Rnf128), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rnf128 (66889)
Length:
2638
CDS:
139..1347

Additional Resources:

NCBI RefSeq record:
NM_001254761.1
NBCI Gene record:
Rnf128 (66889)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001254761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320525 GCTGATAGAAAGAGGTAATTG pLKO_005 417 CDS 100% 13.200 18.480 N RNF128 n/a
2 TRCN0000235623 TGCCAATCAGGGCCTAGTTTA pLKO_005 1394 3UTR 100% 13.200 18.480 N Rnf128 n/a
3 TRCN0000040490 CGCATCCTAACCTGCAATCAT pLKO.1 931 CDS 100% 5.625 7.875 N Rnf128 n/a
4 TRCN0000004794 GTGCTTATATTGATCTGGAAT pLKO.1 1767 3UTR 100% 4.950 6.930 N RNF128 n/a
5 TRCN0000235619 GCAGCTGTTCGGGAGATTAAA pLKO_005 1321 CDS 100% 15.000 12.000 N Rnf128 n/a
6 TRCN0000235622 CATCCTAACCTGCAATCATAT pLKO_005 933 CDS 100% 13.200 9.240 N Rnf128 n/a
7 TRCN0000004796 CGCTGATAGAAAGAGGTAATT pLKO.1 416 CDS 100% 13.200 9.240 N RNF128 n/a
8 TRCN0000235620 TGGCCCTTGGGTGAATCATTA pLKO_005 657 CDS 100% 13.200 9.240 N Rnf128 n/a
9 TRCN0000040488 CCACACAAGATTATAGACATA pLKO.1 1979 3UTR 100% 4.950 3.465 N Rnf128 n/a
10 TRCN0000040492 CCATGTTGACAACCCAACCTT pLKO.1 1272 CDS 100% 3.000 2.100 N Rnf128 n/a
11 TRCN0000040491 GCAGTTAAAGGCAGATGCTAA pLKO.1 795 CDS 100% 4.950 2.970 N Rnf128 n/a
12 TRCN0000320527 TGCCAATCAGGGCCTAGTTTC pLKO_005 1394 3UTR 100% 10.800 15.120 N RNF128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001254761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.