Transcript: Mouse NM_001255999.2

Mus musculus calcium channel, voltage-dependent, L type, alpha 1C subunit (Cacna1c), transcript variant 7, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cacna1c (12288)
Length:
13340
CDS:
179..6688

Additional Resources:

NCBI RefSeq record:
NM_001255999.2
NBCI Gene record:
Cacna1c (12288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001255999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433237 TACAACCAGGAGGGCATAATA pLKO_005 1163 CDS 100% 15.000 21.000 N Cacna1c n/a
2 TRCN0000044676 CCAGGGATGTTAGTCTGTATT pLKO.1 2441 CDS 100% 13.200 18.480 N CACNA1C n/a
3 TRCN0000425134 CCGTAGGAGCACGTTCGATAA pLKO_005 2320 CDS 100% 10.800 15.120 N Cacna1c n/a
4 TRCN0000068851 GCGTGCATAAGCATTGTTGAA pLKO.1 614 CDS 100% 4.950 6.930 N Cacna1c n/a
5 TRCN0000434162 AGAATGCAAGGGTAACTATAT pLKO_005 3469 CDS 100% 13.200 10.560 N Cacna1c n/a
6 TRCN0000068849 CCACGGTGAATCAGGAGATAT pLKO.1 5739 CDS 100% 13.200 10.560 N Cacna1c n/a
7 TRCN0000044675 GCACCAGTACAAAGTGTGGTA pLKO.1 3889 CDS 100% 2.640 2.112 N CACNA1C n/a
8 TRCN0000068850 CCAGAGACAATGTGTGGAATA pLKO.1 3823 CDS 100% 10.800 7.560 N Cacna1c n/a
9 TRCN0000068848 GCCCAGTAACTTGTTCCAATT pLKO.1 7526 3UTR 100% 10.800 7.560 N Cacna1c n/a
10 TRCN0000068852 CGCCATGAATATACTCAACAT pLKO.1 4015 CDS 100% 4.950 3.465 N Cacna1c n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 11437 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001255999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.