Transcript: Mouse NM_001256098.1

Mus musculus deltex 2, E3 ubiquitin ligase (Dtx2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dtx2 (74198)
Length:
2520
CDS:
406..2127

Additional Resources:

NCBI RefSeq record:
NM_001256098.1
NBCI Gene record:
Dtx2 (74198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001256098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041088 GTGGGACTATACTCATTGTTT pLKO.1 1766 CDS 100% 5.625 4.500 N Dtx2 n/a
2 TRCN0000316824 GTGGGACTATACTCATTGTTT pLKO_005 1766 CDS 100% 5.625 4.500 N Dtx2 n/a
3 TRCN0000041091 GTGACTTCAGACATCGCTGTT pLKO.1 949 CDS 100% 4.050 3.240 N Dtx2 n/a
4 TRCN0000316822 GTGACTTCAGACATCGCTGTT pLKO_005 949 CDS 100% 4.050 3.240 N Dtx2 n/a
5 TRCN0000041089 CTCCTTCATTGAGCAGCATTT pLKO.1 522 CDS 100% 10.800 7.560 N Dtx2 n/a
6 TRCN0000349278 CTCCTTCATTGAGCAGCATTT pLKO_005 522 CDS 100% 10.800 7.560 N Dtx2 n/a
7 TRCN0000041092 CGGCAATGCTACCTGCCAGAT pLKO.1 1861 CDS 100% 1.350 0.945 N Dtx2 n/a
8 TRCN0000316821 CGGCAATGCTACCTGCCAGAT pLKO_005 1861 CDS 100% 1.350 0.945 N Dtx2 n/a
9 TRCN0000041090 CCCATACAATAAACCTTCACT pLKO.1 1137 CDS 100% 3.000 1.800 N Dtx2 n/a
10 TRCN0000316893 CCCATACAATAAACCTTCACT pLKO_005 1137 CDS 100% 3.000 1.800 N Dtx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256098.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.