Transcript: Human NM_001256397.2

Homo sapiens beta-carotene oxygenase 2 (BCO2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
BCO2 (83875)
Length:
2786
CDS:
108..1727

Additional Resources:

NCBI RefSeq record:
NM_001256397.2
NBCI Gene record:
BCO2 (83875)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434924 GGTAGATTGGAGCAAATTTAT pLKO_005 638 CDS 100% 15.000 21.000 N BCO2 n/a
2 TRCN0000437823 GGCTGTGGCTTTCGGCATTTA pLKO_005 1452 CDS 100% 13.200 18.480 N BCO2 n/a
3 TRCN0000433156 GGGCTTGATCAGGTCCATAAT pLKO_005 1188 CDS 100% 13.200 18.480 N BCO2 n/a
4 TRCN0000064922 GCCATGACTGACAATACTAAT pLKO.1 522 CDS 100% 13.200 10.560 N BCO2 n/a
5 TRCN0000436085 GGTTTCTCCTATAAGGTTATT pLKO_005 741 CDS 100% 13.200 10.560 N BCO2 n/a
6 TRCN0000416218 ATGGCTCTCTACTTCGAATTG pLKO_005 247 CDS 100% 10.800 7.560 N BCO2 n/a
7 TRCN0000076432 CCTTCTTACTACCATAGCTTT pLKO.1 849 CDS 100% 4.950 3.465 N Bco2 n/a
8 TRCN0000064918 GCAAGTTTCTACAGAGTGATA pLKO.1 373 CDS 100% 4.950 3.465 N BCO2 n/a
9 TRCN0000064921 GCTGTCAAGATAATGGAAGAA pLKO.1 1123 CDS 100% 4.950 3.465 N BCO2 n/a
10 TRCN0000438185 GAATGGGTAGGCCTCTGTAAA pLKO_005 2437 3UTR 100% 13.200 7.920 N Rps12 n/a
11 TRCN0000064920 CCCAACCAGAATGAAAGCAAT pLKO.1 1605 CDS 100% 4.950 2.970 N BCO2 n/a
12 TRCN0000064919 GCTTCTACAGAGAAAGGGAAA pLKO.1 828 CDS 100% 4.050 2.430 N BCO2 n/a
13 TRCN0000104197 GTTGATGACAACAAGAAACTA pLKO.1 2413 3UTR 100% 5.625 2.813 Y Rps12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.