Transcript: Human NM_001256403.2

Homo sapiens PRELI domain containing 3B (PRELID3B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PRELID3B (51012)
Length:
2413
CDS:
57..551

Additional Resources:

NCBI RefSeq record:
NM_001256403.2
NBCI Gene record:
PRELID3B (51012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122136 GCATGATATGTCAGGTTATTT pLKO.1 1400 3UTR 100% 15.000 21.000 N PRELID3B n/a
2 TRCN0000144678 GCTAGAAGATGATTAGCTCTT pLKO.1 1814 3UTR 100% 4.050 2.835 N PRELID3B n/a
3 TRCN0000144906 GAAGCAATGGAATGGGTAATA pLKO.1 438 CDS 100% 13.200 6.600 Y PRELID3B n/a
4 TRCN0000121980 GCAAGTACGATATCCTCAAAT pLKO.1 402 CDS 100% 13.200 6.600 Y PRELID3B n/a
5 TRCN0000139225 CCAAGTGTGGTTGGAGTTGAT pLKO.1 147 CDS 100% 4.950 2.475 Y PRELID3B n/a
6 TRCN0000145178 GAAGCCATAATTACCGTGAAA pLKO.1 345 CDS 100% 4.950 2.475 Y PRELID3B n/a
7 TRCN0000145157 GTTTCAGTAGATGAGAGACTT pLKO.1 276 CDS 100% 4.950 2.475 Y PRELID3B n/a
8 TRCN0000143191 GAGAAGCAATGGAATGGGTAA pLKO.1 436 CDS 100% 4.050 2.025 Y PRELID3B n/a
9 TRCN0000143211 GCAGAAATACCCAAACCCTAT pLKO.1 122 CDS 100% 4.050 2.025 Y PRELID3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.