Transcript: Human NM_001256424.2

Homo sapiens guanylate cyclase 1 soluble subunit alpha 2 (GUCY1A2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GUCY1A2 (2977)
Length:
16243
CDS:
422..2713

Additional Resources:

NCBI RefSeq record:
NM_001256424.2
NBCI Gene record:
GUCY1A2 (2977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424936 GGTGCGAATGCCACGTTATTG pLKO_005 2398 CDS 100% 13.200 18.480 N GUCY1A2 n/a
2 TRCN0000423962 GTGTACTCCCATGCAAGTAAT pLKO_005 2029 CDS 100% 13.200 18.480 N GUCY1A2 n/a
3 TRCN0000078319 CCAACCACTTACCAATTATTA pLKO.1 2492 CDS 100% 15.000 10.500 N GUCY1A2 n/a
4 TRCN0000078318 CTGTATTATGTCAGGCAATAA pLKO.1 2834 3UTR 100% 13.200 9.240 N GUCY1A2 n/a
5 TRCN0000412930 TTCAGTGTACTGCTAATATAC pLKO_005 885 CDS 100% 13.200 9.240 N GUCY1A2 n/a
6 TRCN0000078322 CTGTCTTACTTTCCTTATCAA pLKO.1 1282 CDS 100% 5.625 3.938 N GUCY1A2 n/a
7 TRCN0000078321 CCAGACAACTTTCCAAAGGAA pLKO.1 2561 CDS 100% 3.000 2.100 N GUCY1A2 n/a
8 TRCN0000078320 CCAAAGGTTAATGCCACCTTT pLKO.1 1526 CDS 100% 0.495 0.347 N GUCY1A2 n/a
9 TRCN0000420774 GTGATGTAGCCCAGCAATTAT pLKO_005 1920 CDS 100% 15.000 9.000 N GUCY1A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.