Transcript: Human NM_001256525.2

Homo sapiens zinc finger protein 74 (ZNF74), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ZNF74 (7625)
Length:
3572
CDS:
364..2085

Additional Resources:

NCBI RefSeq record:
NM_001256525.2
NBCI Gene record:
ZNF74 (7625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256525.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017547 ACACCTGCTCAGCACATACTA pLKO.1 1920 CDS 100% 5.625 7.875 N ZNF74 n/a
2 TRCN0000432942 CAAAGCTCTTGTGCGTGGTTC pLKO_005 2015 CDS 100% 4.050 5.670 N ZNF74 n/a
3 TRCN0000430541 CAGAACCACTGTCTCATTAAA pLKO_005 1765 CDS 100% 15.000 10.500 N ZNF74 n/a
4 TRCN0000429096 AGGGTGCCTCCTCTAGTTAAA pLKO_005 2228 3UTR 100% 13.200 9.240 N ZNF74 n/a
5 TRCN0000434315 TCCAAGGAATCGGTGAGTTTC pLKO_005 265 5UTR 100% 10.800 7.560 N ZNF74 n/a
6 TRCN0000427164 ACCTCGAAACTAACATGATGT pLKO_005 2073 CDS 100% 4.950 3.465 N ZNF74 n/a
7 TRCN0000412828 ATCCCTCACCGTGCATGAGAA pLKO_005 1353 CDS 100% 4.950 3.465 N ZNF74 n/a
8 TRCN0000416774 CCTTGGCCATCCAGTTCAACA pLKO_005 1898 CDS 100% 4.950 3.465 N ZNF74 n/a
9 TRCN0000017544 GAAGTCGTTTAAGTGTGAGAA pLKO.1 1809 CDS 100% 4.950 3.465 N ZNF74 n/a
10 TRCN0000017543 GCTGCTTTCTGAGCTACTCAA pLKO.1 2109 3UTR 100% 4.950 3.465 N ZNF74 n/a
11 TRCN0000425498 TTGATGGGCCTGGAAGTTGTT pLKO_005 2328 3UTR 100% 4.950 3.465 N ZNF74 n/a
12 TRCN0000412713 TTGCTGGACACACGCAAGAAC pLKO_005 739 CDS 100% 4.950 3.465 N ZNF74 n/a
13 TRCN0000423876 GAACTACCAGAACCTTCTTGC pLKO_005 372 CDS 100% 4.050 2.835 N ZNF74 n/a
14 TRCN0000413118 GAAGGCTTACAAGTGCGATGA pLKO_005 969 CDS 100% 4.050 2.835 N ZNF74 n/a
15 TRCN0000017545 CCCTCTCAACAGCAGGGCATT pLKO.1 514 CDS 100% 1.350 0.945 N ZNF74 n/a
16 TRCN0000017546 CCTCCACTGCACAAGCCAGAT pLKO.1 400 CDS 100% 1.350 0.945 N ZNF74 n/a
17 TRCN0000415811 GCTGAGGTGGGAGGATCATTT pLKO_005 2572 3UTR 100% 13.200 6.600 Y SULT1A1 n/a
18 TRCN0000107779 GCGCATCCACACGGGCGAGAA pLKO.1 1119 CDS 100% 0.000 0.000 Y ZNF787 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256525.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07158 pDONR223 100% 88.9% 88.8% None 0_1ins213;299T>C n/a
Download CSV