Transcript: Human NM_001256695.1

Homo sapiens PR/SET domain 11 (PRDM11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
PRDM11 (56981)
Length:
10744
CDS:
246..3779

Additional Resources:

NCBI RefSeq record:
NM_001256695.1
NBCI Gene record:
PRDM11 (56981)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358536 GACAAGAACAACCGCTATAAG pLKO_005 738 CDS 100% 13.200 18.480 N PRDM11 n/a
2 TRCN0000016889 CCCTAACTGTATTCGCCTAAA pLKO.1 1478 CDS 100% 10.800 15.120 N PRDM11 n/a
3 TRCN0000358534 CCTAACTGTATTCGCCTAAAG pLKO_005 1479 CDS 100% 10.800 15.120 N PRDM11 n/a
4 TRCN0000016888 GCGATGTGTAAACGAGGTCAT pLKO.1 632 CDS 100% 4.050 5.670 N PRDM11 n/a
5 TRCN0000367873 CCCATGGTGTGCAGAATATAG pLKO_005 1294 CDS 100% 13.200 9.240 N PRDM11 n/a
6 TRCN0000016890 GTGGACAAGAACAACCGCTAT pLKO.1 735 CDS 100% 4.050 2.835 N PRDM11 n/a
7 TRCN0000016891 CGAGAACATGAAGGAGTGCTT pLKO.1 251 CDS 100% 2.640 1.848 N PRDM11 n/a
8 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 5087 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.