Transcript: Human NM_001257291.2

Homo sapiens solute carrier family 9 member A7 (SLC9A7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
SLC9A7 (84679)
Length:
9971
CDS:
90..2270

Additional Resources:

NCBI RefSeq record:
NM_001257291.2
NBCI Gene record:
SLC9A7 (84679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001257291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043812 CTTGGATCTATACTGGCCTAT pLKO.1 711 CDS 100% 4.050 5.670 N SLC9A7 n/a
2 TRCN0000043808 GCTGTTTCATGCTTCATTATT pLKO.1 747 CDS 100% 15.000 10.500 N SLC9A7 n/a
3 TRCN0000435060 GACTGAACACTCACGCCTTTG pLKO_005 1015 CDS 100% 6.000 4.200 N SLC9A7 n/a
4 TRCN0000043810 CAGCTCTTTGAGGTGTTACAT pLKO.1 1323 CDS 100% 5.625 3.938 N SLC9A7 n/a
5 TRCN0000414968 GCGGAAAGTTCTTCGAATACA pLKO_005 529 CDS 100% 5.625 3.938 N SLC9A7 n/a
6 TRCN0000043811 CCCTCCGAAGAGGACCAGAAT pLKO.1 1722 CDS 100% 1.650 1.155 N SLC9A7 n/a
7 TRCN0000043809 GCTGGCGATATTTAATGAATT pLKO.1 890 CDS 100% 0.000 0.000 N SLC9A7 n/a
8 TRCN0000130981 CCTCCTGATTAGCTGGGATTA pLKO.1 3169 3UTR 100% 10.800 5.400 Y TANGO2 n/a
9 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 4549 3UTR 100% 4.050 2.025 Y ERN2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3306 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 4077 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3306 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001257291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.