Transcript: Human NM_001258332.1

Homo sapiens galactose-1-phosphate uridylyltransferase (GALT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
GALT (2592)
Length:
1282
CDS:
319..1131

Additional Resources:

NCBI RefSeq record:
NM_001258332.1
NBCI Gene record:
GALT (2592)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035534 CCGGAAATTCATGGTTGGCTA pLKO.1 987 CDS 100% 2.640 3.696 N GALT n/a
2 TRCN0000290771 CCGGAAATTCATGGTTGGCTA pLKO_005 987 CDS 100% 2.640 3.696 N GALT n/a
3 TRCN0000035535 CCATCAGCATATCCGCTACAA pLKO.1 200 5UTR 100% 4.950 3.960 N GALT n/a
4 TRCN0000307235 CCATCAGCATATCCGCTACAA pLKO_005 200 5UTR 100% 4.950 3.960 N GALT n/a
5 TRCN0000035536 GCTCTTGACCAAGTATGACAA pLKO.1 834 CDS 100% 4.950 3.465 N GALT n/a
6 TRCN0000290702 GCTCTTGACCAAGTATGACAA pLKO_005 834 CDS 100% 4.950 3.465 N GALT n/a
7 TRCN0000035537 GCCAGCAGTTTCCTGCCAGAT pLKO.1 562 CDS 100% 1.350 0.945 N GALT n/a
8 TRCN0000290772 GCCAGCAGTTTCCTGCCAGAT pLKO_005 562 CDS 100% 1.350 0.945 N GALT n/a
9 TRCN0000035538 CTAACCAGTGAGCACTGGTTA pLKO.1 691 CDS 100% 0.495 0.347 N GALT n/a
10 TRCN0000290703 CTAACCAGTGAGCACTGGTTA pLKO_005 691 CDS 100% 0.495 0.347 N GALT n/a
11 TRCN0000328465 ACCCTTGGGTGCAGATCTTTG pLKO_005 485 CDS 100% 10.800 6.480 N Galt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06253 pDONR223 100% 71.1% 65% None 0_1ins202;49_50ins125;613A>G n/a
2 ccsbBroad304_06253 pLX_304 0% 71.1% 65% V5 0_1ins202;49_50ins125;613A>G n/a
Download CSV